Home |
Search |
Today's Posts |
#1
![]()
Posted to microsoft.public.excel.programming
|
|||
|
|||
![]()
I was given this code, which extracts lines of text from a range of selected text files. At the time I thought I only wanted one line to be extracted per file (more precisely the name in one column and the rest of the file in another column). Then I discovered that there are multiple lines per file.
I just need the code tweaked so that there is a loop, and every time a new is encountered a new row is created in the spreadsheet, and the letters following that are inserted next to the name (which appears before the ). Thanks! An example text file is: Shrew_1043_16Sa_G07_19.ab1 GATTAGAGGCMTGCTKGCCAGTGACATAAGTTAAACGGCCGCGGTATCCT GACCGTGCAAAGGTAGCWTAATCATTTGTTCCTTAATTAGGGACTAGTAT GAATGGCCACACGAGGGTTTAACTGTCTCTTATTTCTAATCAGTGAAATT GACCTTCCCGTGAAGAGGCGGGAATAATAAAATAAGACGAGAAGACCCTA TGGAGCTTAAATTATATAACCCAATAATATATATAATCACGTACCTAACT AGGGATTAAAAACTATTTATCTGGGGTATAGATTTCGGTTGGGGTGACCT CGGAGTATAAAATAACCTCCGAGCGATTTAGACCAAGATTAACAGATCGA AGTAATAAATCAAATATTGATCCAATCCAATTGATCAACGAAACAAGTTA CCCTAGGGATAACAGCGCAATCCTATTCAAGAGTCCCTATCGACAATAGG GTTTACGACCTCGATGTTGGATCAGGACATCCCAATGGTGCAGCAGCTAT TAATGGTTCGTTTGTTCAACGATTAAAGTCCTACGTGATCTGATYCCGAA AMCSGGA Shrew_1043_16Sa_G07_20.ab1 GATTAGAGGCMTGCTKGCCAGTGACATAAGTTAAACGGCCGCGGTATCCT GACCGTGCAAAGGTAGCWTAATCATTTGTTCCTTAATTAGGGACTAGTAT GAATGGCCACACGAGGGTTTAACTGTCTCTTATTTCTAATCAGTGAAATT GACCTTCCCGTGAAGAGGCGGGAATAATAAAATAAGACGAGAAGACCCTA TGGAGCTTAAATTATATAACCCAATAATATATATAATCACGTACCTAACT AGGGATTAAAAACTATTTATCTGGGGTATAGATTTCGGTTGGGGTGACCT CGGAGTATAAAATAACCTCCGAGCGATTTAGACCAAGATTAACAGATCGA AGTAATAAATCAAATATTGATCCAATCCAATTGATCAACGAAACAAGTTA CCCTAGGGATAACAGCGCAATCCTATTCAAGAGTCCCTATCGACAATAGG GTTTACGACCTCGATGTTGGATCAGGACATCCCAATGGTGCAGCAGCTAT TAATGGTTCGTTTGTTCAACGATTAAAGTCCTACGTGATCTGATYCCGAA AMCSGGA Public RowCT As Long Public Mysheet As Worksheet Sub Control() ActiveWorkbook.Sheets.Add ActiveSheet.Name = "Fasta Files " & Format(Now(), "YYYY MM DD HH_NN_SS") Set Mysheet = ActiveSheet RowCT = 0 Call GetMyFiles("C:\WINDOWS\", "*.fasta") End Sub Private Sub GetMyFiles(sPath As String, sFileType As String) ' Requires reference to Microsoft Office 11.0 Object Library. 'Dim fDialog As Office.FileDialog Dim varFile As Variant ' Clear listbox contents. ' Me.FileList.RowSource = "" ' Set up the File Dialog. 'Set fDialog = Application.FileDialog(msoFileDialogFilePicker) With Application.FileDialog(msoFileDialogFilePicker) .AllowMultiSelect = True .InitialFileName = sPath .InitialView = msoFileDialogViewDetails ' Set the title of the dialog box. .Title = "Please select one or more fasta files" ' Clear out the current filters, and add our own. .Filters.Clear .Filters.Add "", sFileType ' Show the dialog box. If the .Show method returns True, the ' user picked at least one file. If the .Show method returns ' False, the user clicked Cancel. If .Show = True Then 'Loop through each file selected and add it to our list box. For Each varFile In .SelectedItems Call Processfile(varFile) Next Else MsgBox "You clicked Cancel in the file dialog box." End If End With End Sub Sub Processfile(sPathAndFileName As Variant) Dim fno As Integer Dim tstring As String Dim sMainstr As String Dim col As Long fno = FreeFile RowCT = RowCT + 1 col = 1 Cells(RowCT, col) = sPathAndFileName col = col + 1 sMainstr = "" Open sPathAndFileName For Input As #fno Line Input #fno, tstring If InStr(1, tstring, "") 0 Then tstring = Left(tstring, InStr(1, tstring, ".") - 1) Cells(RowCT, col) = tstring Cells(RowCT, col).TextToColumns Destination:=Cells(RowCT, col), DataType:=xlDelimited, TextQualifier:=xlDoubleQuote, ConsecutiveDelimiter:=False, Tab:=False, Semicolon:=False, Comma:=False, Space:=False, Other:=True, OtherChar:="_" col = Cells(RowCT, col).End(xlToRight).Column End If While Not EOF(fno) Line Input #fno, tstring sMainstr = sMainstr & tstring Wend col = col + 1 Cells(RowCT, col) = sMainstr Close #fno End Sub |
#2
![]()
Posted to microsoft.public.excel.programming
|
|||
|
|||
![]()
Sorry, I meant that the name is on the line starting with and the next line is the text that needs to be associated with that name.
On Tuesday, July 17, 2012 3:42:09 PM UTC+2, (unknown) wrote: I was given this code, which extracts lines of text from a range of selected text files. At the time I thought I only wanted one line to be extracted per file (more precisely the name in one column and the rest of the file in another column). Then I discovered that there are multiple lines per file. I just need the code tweaked so that there is a loop, and every time a new > is encountered a new row is created in the spreadsheet, and the letters following that > are inserted next to the name (which appears before the >). Thanks! An example text file is: >Shrew_1043_16Sa_G07_19.ab1 GATTAGAGGCMTGCTKGCCAGTGACATAAGTTAAACGGCCGCGGTATCCT GACCGTGCAAAGGTAGCWTAATCATTTGTTCCTTAATTAGGGACTAGTAT GAATGGCCACACGAGGGTTTAACTGTCTCTTATTTCTAATCAGTGAAATT GACCTTCCCGTGAAGAGGCGGGAATAATAAAATAAGACGAGAAGACCCTA TGGAGCTTAAATTATATAACCCAATAATATATATAATCACGTACCTAACT AGGGATTAAAAACTATTTATCTGGGGTATAGATTTCGGTTGGGGTGACCT CGGAGTATAAAATAACCTCCGAGCGATTTAGACCAAGATTAACAGATCGA AGTAATAAATCAAATATTGATCCAATCCAATTGATCAACGAAACAAGTTA CCCTAGGGATAACAGCGCAATCCTATTCAAGAGTCCCTATCGACAATAGG GTTTACGACCTCGATGTTGGATCAGGACATCCCAATGGTGCAGCAGCTAT TAATGGTTCGTTTGTTCAACGATTAAAGTCCTACGTGATCTGATYCCGAA AMCSGGA >Shrew_1043_16Sa_G07_20.ab1 GATTAGAGGCMTGCTKGCCAGTGACATAAGTTAAACGGCCGCGGTATCCT GACCGTGCAAAGGTAGCWTAATCATTTGTTCCTTAATTAGGGACTAGTAT GAATGGCCACACGAGGGTTTAACTGTCTCTTATTTCTAATCAGTGAAATT GACCTTCCCGTGAAGAGGCGGGAATAATAAAATAAGACGAGAAGACCCTA TGGAGCTTAAATTATATAACCCAATAATATATATAATCACGTACCTAACT AGGGATTAAAAACTATTTATCTGGGGTATAGATTTCGGTTGGGGTGACCT CGGAGTATAAAATAACCTCCGAGCGATTTAGACCAAGATTAACAGATCGA AGTAATAAATCAAATATTGATCCAATCCAATTGATCAACGAAACAAGTTA CCCTAGGGATAACAGCGCAATCCTATTCAAGAGTCCCTATCGACAATAGG GTTTACGACCTCGATGTTGGATCAGGACATCCCAATGGTGCAGCAGCTAT TAATGGTTCGTTTGTTCAACGATTAAAGTCCTACGTGATCTGATYCCGAA AMCSGGA Public RowCT As Long Public Mysheet As Worksheet Sub Control() ActiveWorkbook.Sheets.Add ActiveSheet.Name = "Fasta Files " & Format(Now(), "YYYY MM DD HH_NN_SS") Set Mysheet = ActiveSheet RowCT = 0 Call GetMyFiles("C:\WINDOWS\", "*.fasta") End Sub Private Sub GetMyFiles(sPath As String, sFileType As String) ' Requires reference to Microsoft Office 11.0 Object Library. 'Dim fDialog As Office.FileDialog Dim varFile As Variant ' Clear listbox contents. ' Me.FileList.RowSource = "" ' Set up the File Dialog. 'Set fDialog = Application.FileDialog(msoFileDialogFilePicker) With Application.FileDialog(msoFileDialogFilePicker) .AllowMultiSelect = True .InitialFileName = sPath .InitialView = msoFileDialogViewDetails ' Set the title of the dialog box. .Title = "Please select one or more fasta files" ' Clear out the current filters, and add our own. .Filters.Clear .Filters.Add "", sFileType ' Show the dialog box. If the .Show method returns True, the ' user picked at least one file. If the .Show method returns ' False, the user clicked Cancel. If .Show = True Then 'Loop through each file selected and add it to our list box. For Each varFile In .SelectedItems Call Processfile(varFile) Next Else MsgBox "You clicked Cancel in the file dialog box." End If End With End Sub Sub Processfile(sPathAndFileName As Variant) Dim fno As Integer Dim tstring As String Dim sMainstr As String Dim col As Long fno = FreeFile RowCT = RowCT + 1 col = 1 Cells(RowCT, col) = sPathAndFileName col = col + 1 sMainstr = "" Open sPathAndFileName For Input As #fno Line Input #fno, tstring If InStr(1, tstring, ">") > 0 Then tstring = Left(tstring, InStr(1, tstring, ".") - 1) Cells(RowCT, col) = tstring Cells(RowCT, col).TextToColumns Destination:=Cells(RowCT, col), DataType:=xlDelimited, TextQualifier:=xlDoubleQuote, ConsecutiveDelimiter:=False, Tab:=False, Semicolon:=False, Comma:=False, Space:=False, Other:=True, OtherChar:="_" col = Cells(RowCT, col).End(xlToRight).Column End If While Not EOF(fno) Line Input #fno, tstring sMainstr = sMainstr & tstring Wend col = col + 1 Cells(RowCT, col) = sMainstr Close #fno End Sub |
Reply |
Thread Tools | Search this Thread |
Display Modes | |
|
|
![]() |
||||
Thread | Forum | |||
Excel 2007 text import as text not date | Excel Discussion (Misc queries) | |||
How to Start Excel in Text Import Wizard for data import | Setting up and Configuration of Excel | |||
How to Import Visio Text Boxes into Excel as Text | Excel Discussion (Misc queries) | |||
Import text file : why do fractions in text format result in month/day? | Excel Programming | |||
Excel Text Import creates garbage text | Excel Discussion (Misc queries) |